Anapc13 (NM_181394) Mouse Untagged Clone

CAT#: MC204684

Anapc13 (untagged) - Mouse anaphase promoting complex subunit 13 (Anapc13), (10ug)


  "NM_181394" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Anapc13"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Anapc13
Synonyms 1810004D07Rik; APC13; SWM1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028526
GACGCGCGCGCAGTGGGCCTGACAAGATCAAAGCTGCAGGAGGATGGACAGTGAGGTACAGCGAGATGGA AGGATCTTGGACCTGATTGATGATGCTTGGCGGGAAGATAAGCTGCCATATGAGGATGTCGCCATTCCAC TGAGTGAGCTTCCTGAGCCCGAGCAAGACAACGGAGGCACCACAGAGTCTGTGAAAGAACAGGAGATGAA GTGGACAGACCTGGCCTTACAGGGCCTCCACGAGAACGTCCCACCCGCTGGAAACTGATGCCGGGCTCCT TCCCACGGACGGAGTTTTCAAACATATGGGGATAAAAATGTTTCCTGTCGCCAAATGCAGATCTTTAGCA ATAAATCAACACTCAAAAGCATAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_181394
ORF Size 225 bp
Insert Size 225
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028526, AAH28526
RefSeq Size 395
RefSeq ORF 225
Locus ID 69010

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.