Gast (NM_010257) Mouse Untagged Clone

CAT#: MC204768

Gast (untagged) - Mouse gastrin (Gast), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gast
• Synonyms: GAS
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC064791
  CGGACGCGTGGGAGCGCCACAACAGCCAACTATTCCCCAGCTCTGTGGACAAGATGCCTCGACTGTGTGT GTACATGCTGGTCTTAGTGCTGGCTCTAGCTACCTTCTCGGAAGCTTCTTGGAAGCCCCGCTCCCAGCTA CAGGATGCATCATCTGGACCAGGGACCAATGAGGACCTGGAACAGCGCCAGTTCAACAAGCTGGGCTCAG CCTCTCACCATCGAAGGCAGCTGGGGCTCCAGGGTCCTCAACACTTCATAGCAGACCTGTCCAAGAAGCA GAGGCCACGAATGGAGGAAGAAGAAGAGGCCTACGGATGGATGGACTTTGGCCGCCGCAGTGCTGAGGAA GACCAGTAGGACTAGCAACACTCTTCCAGAGCCCAGCCATCTCCAGCCACCCCTCCCCCAGCTCCGTCCT TACAAAACATATTAAAAATAAGCTAGCTTCCAATGTAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_010257
• ORF Size: 306 bp
• Insert Size: 306
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC064791, AAH64791
• RefSeq Size: 478
• RefSeq ORF: 306
• Locus ID: 14459
• Gene Summary: This gene encodes the peptide hormone gastrin, which stimulates gastric acid secretion, proliferation, cell migration and angiogenesis, as well as inhibits apoptosis. The encoded preproprotein undergoes proteolytic processing to generate multiple gastrin peptides differing in size. Mice lacking the encoded protein exhibit a decrease in the number of parietal cells, achlorohydria and a decrease in the colonic proliferation. [provided by RefSeq, Nov 2015]