Ccl19 (NM_011888) Mouse Untagged Clone
CAT#: MC204795
Ccl19 (untagged) - Mouse chemokine (C-C motif) ligand 19 (Ccl19), (10ug)
"NM_011888" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Symbol | Ccl19 |
| Synonyms | CKb11; ELC; exodus-3; MIP3B; Scya19 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC051472
GGCACGAGGCACAAGCTCACTTGCACTTGGCTCCTGAACCCCTTCACGCCACAGGAGGACATCTGAGCGA TTCCCATCACTCCCCTGTGAACCCGTCGGAGCCTCGGCCTCTCAGATTCTTGCGCACACAGTCTCTCAGG CTCACTCACTCTCTGTGGCCTGCCTCAGATCATCTGCCATGGCCCCCCGTGTGACCCCACTCCTGGCCTT CAGCCTGCTGGTTCTCTGGACCTTCCCAGCCCCAACTCTGGGGGGTGCTAATGATGCGGAAGACTGCTGC CTGTCTGTGACCCAGCGCCCCATCCCTGGGAACATCGTGAAAGCCTTCCGCTACCTTCTTAATGAAGATG GCTGCAGGGTGCCTGCTGTTGTGTTCACCACACTAAGGGGCTATCAGCTCTGTGCACCTCCTGACCAGCC CTGGGTGGATCGCATCATCCGAAGACTGAAGAAGTCTTCTGCCAAGAACAAAGGCAACAGCACCAGAAGG AGCCCTGTGTCTTGAGTAAAGAGATGTGAATCACTCTGGCCCAGGAAACCAAGGACCAGAAGAGAGGACC AGGCCTCCTGATGCTCTGTCCCAGACCTAACCCAGCCAAGTCTGTGCCTAGAGAGTCGATGTGAGTGTGG ACAAGAGAGTTTGTGTGGCTAGAACACCGTCTCTCTGTGGCTAGACTGCAGTGCTTCCAATAAAAGCCGC TTGGTACCGTGAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_011888 |
| ORF Size | 327 bp |
| Insert Size | 327 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Reference Data | |
| RefSeq | BC051472, AAH51472 |
| RefSeq Size | 734 |
| RefSeq ORF | 327 |
| Locus ID | 24047 |
| Gene Summary | Strongly chemotactic for naive (L-selectinhi) CD4 T-cells and for CD8 T-cells and weakly attractive for resting B-cells and memory (L-selectinlo) CD4 T-cells. May play a role in promoting encounters between recirculating T-cells and dendritic cells and in the migration of activated B-cells into the T-zone of secondary lymphoid tissues. Binds to chemokine receptor CCR7. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4. [UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR222280 | Ccl19 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 19 (Ccl19) |
USD 420.00 |
|
| MG222280 | Ccl19 (GFP-tagged) - Mouse chemokine (C-C motif) ligand 19 (Ccl19), (10ug) |
USD 460.00 |
|
| MR222280L3 | Lenti ORF clone of Ccl19 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 19 (Ccl19) |
USD 620.00 |
|
| MR222280L4 | Lenti ORF clone of Ccl19 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 19 (Ccl19) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China