Fmc1 (NM_025363) Mouse Untagged Clone

CAT#: MC204914

1110001J03Rik (untagged) - Mouse RIKEN cDNA 1110001J03 gene (1110001J03Rik), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025363" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Fmc1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fmc1
Synonyms 1110001J03Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059710
AGGGACCAGGCTCTCCAAGGACAGAAAAATGGCGGCCCTGGGGTCCCCGGCGCGCACTCTGCGGGGCCTT CTGAGGGAGCTGCGCTACCTGAACGCGGCCACCGGGCGGCCATATCGCGACACAGCGGCCTACCGGTACC TCGTTAAGGCTTTCCGAGCACATCGGGTTACCAGTGAGAAGTTGTGTAGAGCCCAACACGAACTTCACTT CCAAGCTGCCACCTATCTCTGCCTTTTGAGTAGCATCCGGCAACATGTAGCCCTTCATCAGGAATTTCAT GGCAAGGGTGAGCGTTCAGTGGAGGAGTCTGCTGGTTTAGTGGGCCTCCAGTTGCCCCGTCAGCCTGGAG GGAAGGGCTGGGAGCCGTGATGCAGAGAGTCCTCAGATGTTCCTTCATTCAAGAGTTTAACCATTTCTAA CAATATGTAGTTATCATTAAATCTTTTTTAAAGTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_025363
ORF Size 342 bp
Insert Size 342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC059710, AAH59710
RefSeq Size 487
RefSeq ORF 342
Locus ID 66117

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.