AA467197 (NM_001004174) Mouse Untagged Clone

CAT#: MC204945

AA467197 (untagged) - Mouse expressed sequence AA467197 (AA467197), (10ug)


  "NM_001004174" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "AA467197"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol AA467197
Synonyms mir-147; Nmes1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC049633
ATATAAGGGCCGCTCGCTTCTGGGCGTTAACATCTCCTGGCCGCAGCCGCCCTAGATTTGGAATTCTACA CTAAAGTCATCATGGGCGTTTTCCAGATATTGATGAAGAATAAGGAACTCATTCCTTTGGCGTTTTTTAT AAGCGTGGCCGCCACCGGGGCCACATCTTTCGCTTTGTATGCGTTGAAAAAAACCGACGTGGTTATTGAT CGGAAAAGAAACCCAGAGCCTTGGGAAATGGTGGATCCTACTCAACCCCAAAAGCTTATAACCATCAACC AGCAATGGAAGCCCGTTGAGGAGCTGCAAAAAGTCCGGAGGGCAACCAGATGATTGCTCACCACTCCTCT CTTCCAAAGAACACTCTATGAATCTAGTGGAAACATTTCTGCACAAACTAGATGTTGATGCCAGTGTGCG GAAATGCTTCTGCTACATTTGTAGGGTTTGCCTGCATTCTTTGGATCCTGCATTAGCAAGTGAAGGTAGC ACATAGTCTAAAATAGTTTTCTGTGTTTATTGGTGTAAATTTCAATTTTACAGTTGAAATTTTATGTTTG TGATGCTTGGATATTTTCCTTGAAATGTATAAACATGTAAAAATTAGATTACTGCCTGTAATAAAATAAT TCGATGACTAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_001004174
Insert Size 252 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC049633, AAH49633
RefSeq Size 672 bp
RefSeq ORF 252 bp
Locus ID 433470
Cytogenetics 2 E5

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.