Mrpl33 (NM_025796) Mouse Untagged Clone

CAT#: MC204964

Mrpl33 (untagged) - Mouse mitochondrial ribosomal protein L33 (Mrpl33), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025796" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Mrpl33"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mrpl33
Synonyms 0610009M10Rik; L33mt; MRP-L33
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059722
AGGCGGGTCTCGGTGAGAATCGGTGGACCATGCTGCTCTCCGCTGTCTCTTTTGCCAAGAGCAAGTCAAA AACTATCCTGGTGAAACTAGTGAGCCAAGCTGGGACAGGTTTCTCCTTCAACCACAAGAGAAGCCGACTC CGAGAGAAGCTGAGCCTTCTGCACTATGATCCAATAGTGAACAAAAAAGTTCTCTTTGTGGAACAGAAAA AAATCCGTTCCCTCTGAGTAGTGGATTGAAAATGAATTTGATTCCTAAATGAGAAGCTCGAGGGTGAGGC ACCGTTTCGAACTCTGCAGTGTGCAATGAAGACGAGGAAGTTCCAGCATGGCCTCGGGGGATGTTGGCTA AGGGACAGAGCCGAAAGAGTCCTTCACAGAGACCACATATTTATCTCCCTGGATGCTTTATAGGCCTTAA TAAAAAAATATCAAAATAGTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_025796
ORF Size 198 bp
Insert Size 198
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC059722, AAH59722
RefSeq Size 474
RefSeq ORF 198
Locus ID 66845

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.