Tbca (NM_009321) Mouse Untagged Clone

CAT#: MC205084

Tbca (untagged) - Mouse tubulin cofactor A (Tbca), (10ug)


  "NM_009321" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Tbca"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tbca
Synonyms Tbca13
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC055749
GGCGCCTTAGGGACCATGGCCGATCCTCGCGTGAGGCAGATCAAGATCAAGACCGGAGTAGTGAGGCGAT TGGTCAAAGAAAGAGTGATGTACGAAAAAGAAGCAAAGCAGCAAGAAGAAAAGATTGAAAAAATGAAGGC TGAAGATGGAGAGAACTACGCCATTAAGAAGCAGGCAGAGATCCTGCAAGAGTCCCGGATGATGATCCCA GATTGCCAGCGTCGGTTAGAGGCTGCATATACTGATCTTCAGCAGATATTAGAAAGTGAAAAAGACTTGG AAGAAGCCGAGGAGTATAAAGAAGCCCGTGTAGTGCTGGATTCCGTAAAGCTAGAAGCCTGACATTTTTC TGTATGGGATGTTTTTTTGCATTAAATCCTGGGGTCCATTCTACAATTCATTGTTTTCAGCCACTGCTGT GTTTAATAATATGAAAACGTGGTTCTTTTTATGCAGTTGCATTTATTTTTCTTTGCATAACTTAATGTGT CAAATAAATGAGTTCATCTAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_009321
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC055749, AAH55749
RefSeq Size 527
RefSeq ORF 327
Locus ID 21371
Gene Summary Tubulin-folding protein; involved in the early step of the tubulin folding pathway. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.