Agrp (NM_007427) Mouse Untagged Clone

CAT#: MC205250

Agrp (untagged) - Mouse agouti related protein (Agrp), (10ug)


  "NM_007427" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Agrp"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Agrp
Synonyms Agrt; Art
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC079902
CGGCCTGAAAGCTTTGTCCTCTGAAGCTGTATGCCCACCGGGGGAACAGTGTTTTCTGCTCCCTTGGTTT CCAGGAACCTTAGGGAGGCACCTCATGCCCTGGCTACAGGAAGCAGTCACGTGTGGACCCTTTATTAGGC ACTGCCATATAAGCTCAGGGCACAAGAGACCAGGACATCCCTAGGCAAAGATCAGCAAGCAAAGGCCATG CTGACTGCAATGTTGCTGAGTTGTGTTCTGCTGTTGGCACTGCCTCCCACACTGGGGGTCCAGATGGGCG TGGCTCCACTGAAGGGCATCAGAAGGCCTGACCAGGCTCTGTTCCCAGAGTTCCCAGGTCTAAGTCTGAA TGGCCTCAAGAAGACAACTGCAGACCGAGCAGAAGAAGTTCTGCTGCAGAAGGCAGAAGCTTTGGCGGAG GTGCTAGATCCACAGAACCGCGAGTCTCGTTCTCCGCGTCGCTGTGTAAGGCTGCACGAGTCCTGCTTGG GACAGCAGGTACCTTGCTGCGACCCGTGCGCTACGTGCTACTGCCGCTTCTTCAATGCCTTTTGCTACTG CCGCAAGCTGGGTACGGCCACGAACCTCTGTAGTCGCACCTAGCCAATGGATGTTGTTTGGGCAAAGGCA GGGGATGAGAATAAAGGATGGGACGGTTTAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_007427
ORF Size 396 bp
Insert Size 396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC079902, AAH79902
RefSeq Size 685
RefSeq ORF 396
Locus ID 11604
Gene Summary This gene encodes a protein that regulates feeding behavior and plays a key role in the control of body weight. The encoded protein acts as an antagonist of melanocortin receptor signaling. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.