Trem2 (NM_031254) Mouse Untagged Clone

CAT#: MC205819

Trem2 (untagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trem2
• Synonyms: TREM-2; Trem2a; Trem2b; Trem2c
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC033485
  CCCACGCGTCCGGCAAGATCTTGCACAAGGTCCCCTCCGGCTGGCTGCTGGCAAAGGAAAGGTGCCATGG GACCTCTCCACCAGTTTCTCCTGCTGCTGATCACAGCCCTGTCCCAAGCCCTCAACACCACGGTGCTGCA GGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACGCAAG GCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC TGGCCTTCCTGAAGAAGTGGAATGGGAGCACAGTCATCGCAGATGACACCCTTGCTGGAACCGTCACCAT CACTCTGAAGAACCTCCAAGCCGGTGACGCGGGCCTCTACCAGTGTCAGAGTCTCCGAGGCCGAGAGGCT GAGGTCCTGCAGAAAGTACTGGTGGAGGTGCTGGAGGACCCTCTAGATGACCAAGATGCTGGAGATCTCT GGGTCCCCGAGGAGTCATCGAGTTTCGAGGGTGCCCAAGTGGAACACAGCACCTCCAGGAATCAAGAGAC CTCCTTCCCACCCACCTCCATTCTTCTCCTCCTGGCCTGCGTTCTCCTGAGCAAGTTTCTTGCAGCCAGC ATCCTCTGGGCTGTGGCCAGGGGCAGGCAGAAGCCGGGAACACCTGTGGTCAGAGGGCTGGACTGTGGCC AAGATGCTGGGCACCAACTTCAGATCCTCACTGGACCCGGAGGTACGTGAGAGAATTCTGAGTGGGAGGA GAACTACAGCTTAAGTCCAGCCAGGAGTCAATCCAGCCTGCATGCTCTCCCCTCCTCCACCAAGACTTCT GTTTCTGCTACTTTTGCTTCAGAGGCCGCCTCTGCCTCAAGCCCACCTATCCTGGGAGCAGGAATACTGG TGTGTACATCTGTGTTGAGTGGGGAAGACAGCTGGATGGTTGTCTGTCAACTTCTGCACTTTGGACATTA AACATTCTCCACACCCCAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_031254
• ORF Size: 684 bp
• Insert Size: 684
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC033485, AAH33485
• RefSeq Size: 1024
• RefSeq ORF: 684
• Locus ID: 83433
• Gene Summary: The protein encoded by this gene is part of the immunoglobulin and lectin-like superfamily and functions as part of the innate immune system. This gene forms part of a cluster of genes on mouse chromosome 17 thought to be involved in innate immunity. This protein associates with the adaptor protein Dap-12 and recruits several factors, such as kinases and phospholipase C-gamma, to form a receptor signaling complex that activates myeloid cells, including dendritic cells and microglia. In humans homozygous loss-of-function mutations in this gene cause Nasu-Hakola disease and mutations in this gene may be risk factors to the development of Alzheimer's disease. In mouse mutations of this gene serve as a pathophysiological model for polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease) and for inflammatory bowel disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (1) encodes isoform 1.