Atp5e (NM_025983) Mouse Untagged Clone

CAT#: MC205835

Atp5e (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025983" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Atp5e"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Atp5e
Synonyms 2410043G19Rik; Atp5f1e; ATPE; AV000645
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024339
CCCACGCGTCCGGACCCACGCGTCCGGCGGCCGGGCCGGTTTGAGGCTACTCTGAAGCGACCCAGCGGTT CTGCCCGACGCGCCCGCTCGAGACACCATGGTGGCGTACTGGCGACAGGCTGGACTCAGCTACATCCGGT TTTCCCAGATCTGTGCAAAAGCAGTGAGGGATGCCCTGAAGACCGAGTTCAAAGCGAACGCTGAGAAGAC TTCGGGCAGCAGCATAAAAATTGTGAAAGTCTCGAAGAAGGAGTAGCTGAATCTGAAGCCTGAAGTGCTG AGTCTTGAAGGTGAAGCATGTGGGCCCCTGTTCTGGCAGATGGAAATCAACCTCACCTCCTGGGGGACAG GCTGCCCATCTCGTTGATAAATTGACTATGCCAATAAATTAACATGGTTCACTTTCAAAAAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025983
ORF Size 159 bp
Insert Size 159
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024339, AAH24339
RefSeq Size 425
RefSeq ORF 159
Locus ID 67126

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.