Gpx6 (BC013526) Mouse Untagged Clone
CAT#: MC206506
Gpx6 (untagged) - Mouse glutathione peroxidase 6 (cDNA clone MGC:19204 IMAGE:4237630), (10ug)
Product Images
Other products for "Gpx6"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Gpx6 |
Synonyms | MGC19204, Ry2d1, RP23-54E4.7 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for BC013526, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGAAGTTGTGGGGTTCCTGTCTTTTCTCATTGTTTATGGCTGCCTTAGCTCAGGAGACTCTGA ATCCTCAAAAATCGAAGGTGGATTGCAACAAAGGGGTGACTGGCACCGTCTATGAGTATGGAGCCAACAC CATAGATGGTGGGGGGTTTGTCAACTTCCAGCAGTATGCAGGAAAGCACATCCTCTTTGTCAACGTGGCA TCCTTCTGTGGCCTGACAGCTACGTACCCTGAGTTGAACACACTGCAGGAGGAGCTGAAGCCATTCAACG TCACGGTTTTGGGCTTTCCGTGCAACCAGTTCGGAAAGCAAGAACCTGGAAAGAACTCAGAGATTCTCCT TGGACTCAAGTATGTGCGTCCAGGCGGTGGCTATGTCCCCAATTTCCAGCTCTTTGAGAAGGGGGATGTG AACGGAGACAATGAACAAAAGGTTTTTTCTTTCCTAAAGAACTCCTGCCCTCCCACCTCTGAACTTTTTG GCTCTCCAGAACATCTCTTCTGGGATCCCATGAAGATTCATGATATCCGCTGGAACTTTGAGAAGTTCCT GGTGGGACCTGATGGAGTCCCTGTCATGCGCTGGTTCCACCATACTCCTGTCAGAATTGTCCAGTCAGAC ATCATGGAGTACCTAAACCAAACCAGTACCCAGTAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC013526 |
ORF Size | 666 bp |
Insert Size | 666 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC013526, AAH13526 |
RefSeq Size | 1324 |
RefSeq ORF | 666 |
Locus ID | 75512 |
Gene Summary | This gene encodes a member of the glutathione peroxidase family. Glutathione peroxidases catalyze the reduction of a variety of hydroperoxides using glutathione as a specific electron donor substrate, and thereby protect cells against oxidative damage. Expression of this gene is restricted to embryos and adult olfactory epithelium. The mouse and rat orthologs contain a cysteine (Cys) residue at the active site, unlike the human counterpart, which is a selenoprotein, containing selenocysteine (Sec) instead. [provided by RefSeq, Jul 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.