Gpx6 (BC013526) Mouse Untagged Clone

CAT#: MC206506

Gpx6 (untagged) - Mouse glutathione peroxidase 6 (cDNA clone MGC:19204 IMAGE:4237630), (10ug)


Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Gpx6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gpx6
Synonyms MGC19204, Ry2d1, RP23-54E4.7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for BC013526, the custom clone sequence may differ by one or more nucleotides


ATGGCCCAGAAGTTGTGGGGTTCCTGTCTTTTCTCATTGTTTATGGCTGCCTTAGCTCAGGAGACTCTGA
ATCCTCAAAAATCGAAGGTGGATTGCAACAAAGGGGTGACTGGCACCGTCTATGAGTATGGAGCCAACAC
CATAGATGGTGGGGGGTTTGTCAACTTCCAGCAGTATGCAGGAAAGCACATCCTCTTTGTCAACGTGGCA
TCCTTCTGTGGCCTGACAGCTACGTACCCTGAGTTGAACACACTGCAGGAGGAGCTGAAGCCATTCAACG
TCACGGTTTTGGGCTTTCCGTGCAACCAGTTCGGAAAGCAAGAACCTGGAAAGAACTCAGAGATTCTCCT
TGGACTCAAGTATGTGCGTCCAGGCGGTGGCTATGTCCCCAATTTCCAGCTCTTTGAGAAGGGGGATGTG
AACGGAGACAATGAACAAAAGGTTTTTTCTTTCCTAAAGAACTCCTGCCCTCCCACCTCTGAACTTTTTG
GCTCTCCAGAACATCTCTTCTGGGATCCCATGAAGATTCATGATATCCGCTGGAACTTTGAGAAGTTCCT
GGTGGGACCTGATGGAGTCCCTGTCATGCGCTGGTTCCACCATACTCCTGTCAGAATTGTCCAGTCAGAC
ATCATGGAGTACCTAAACCAAACCAGTACCCAGTAA


Restriction Sites EcoRI-NotI     
ACCN BC013526
ORF Size 666 bp
Insert Size 666
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC013526, AAH13526
RefSeq Size 1324
RefSeq ORF 666
Locus ID 75512
Gene Summary This gene encodes a member of the glutathione peroxidase family. Glutathione peroxidases catalyze the reduction of a variety of hydroperoxides using glutathione as a specific electron donor substrate, and thereby protect cells against oxidative damage. Expression of this gene is restricted to embryos and adult olfactory epithelium. The mouse and rat orthologs contain a cysteine (Cys) residue at the active site, unlike the human counterpart, which is a selenoprotein, containing selenocysteine (Sec) instead. [provided by RefSeq, Jul 2017]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.