Ccl27 (BC028511) Mouse Untagged Clone
CAT#: MC206570
Ccl27 (untagged) - Mouse chemokine (C-C motif) ligand 27 (cDNA clone MGC:41145 IMAGE:3471454), (10ug)
Product Images
Other products for "Ccl27"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ccl27 |
Synonyms | ALP, mILC, ESkine, CTAK, CTACK, PESKY, ILC |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028511
GCATGATGGAGGGGCTCTCCCCCGCCAGCAGCCTCCCGCTGTTACTGTTGCTTCTGAGCCCGGCTCCTGA AGCAGCCTTGCCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGG CTGCTGAGGAGGATTGTCCACATGGAACTGCAGGAGGCTGATGGGGACTGTCACCTCCAGGCTGTCGTGC TTCACCTGGCTCGGCGCAGTGTCTGTGTTCATCCCCAGAACCGCAGCCTGGCTCGGTGGTTAGAACGCCA AGGGAAAAGGCTCCAAGGAACTGTACCCAGTTTAAATCTGGTACTACAAAAGAAAATGTACTCACACCCC CAACAGCAAAACTAATAAAGCAACATTAGACGACAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC028511 |
ORF Size | 363 bp |
Insert Size | 363 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC028511, AAH28511 |
RefSeq Size | 402 |
RefSeq ORF | 363 |
Locus ID | 20301 |
Gene Summary | Chemotactic factor that attracts skin-associated memory T-lymphocytes. May play a role in mediating homing of lymphocytes to cutaneous sites. May play a role in cell migration during embryogenesis. Nuclear forms may facilitate cellular migration by inducing cytoskeletal relaxation. Binds to CCR10. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.