Sct (BC048484) Mouse Untagged Clone

CAT#: MC207072

Sct (untagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Sct
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC048484
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCCTCCGCTGCCCACGCCGATGCTACTGCTGTTGCTGCTGCTGCTCTCCAGTTCCGCCGCGCTCC
  CTGCACCTCCCAGGACCCCAAGACACTCAGACGGAATGTTCACCAGCGAGCTCAGCCGCTTGCAGGACAG
  TGCCAGGCTGCAGCGCCTGCTGCAGGGTCTGGTGGGGAAGCGCAGCGAGCAGGACACAGAAAATATCCCA
  GAGAACAGCCTGGCCCGGTCCAAGCCCTTAGAGGACCAGCTCTGCTTGCTGTGGTCGAACACTCAGACCC
  TACAGGACTGTCCCCTCTCCTTCCACAGGCTTCTGCCCAGGCTGTCCCTGGATGGGTCCCTGTCTCTCTG
  GCTGCCTCCTGGACCAAGGTCTGCTGTTGATCGTTCAGAGTGGACTGAAACAACCAGGCCACCCAGATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC048484
• ORF Size: 420 bp
• Insert Size: 420
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC048484, AAH48484
• RefSeq Size: 564
• RefSeq ORF: 419
• Locus ID: 20287
• Gene Summary: This gene encodes the precursor of a gastrointestinal peptide hormone of the secretin-glucagon family. The encoded protein is secreted as a prohormone that undergoes proteolytic processing to generate a mature peptide hormone. The mature peptide regulates secretion of gastric acid, biocarbonate ions from pancreatic and biliary duct epithelia and water homeostasis in the gastrointestinal system. Mice lacking the encoded protein display decreased survival of neuroprogenitor cells during early postnatal period and impaired long-term potentiation and spatial learning in adulthood. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may be processed in a similar manner to generate the mature peptide hormone. [provided by RefSeq, Jul 2015]