Otx2 (NM_144841) Mouse Untagged Clone

CAT#: MC207342

Otx2 (untagged) - Mouse orthodenticle homolog 2 (Drosophila) (Otx2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Otx2
• Synonyms: E130306E05Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207342 representing NM_144841
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGTCTTATCTAAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACT
  TGCTGCATCCCTCCGTGGGCTACCCCGCCACCCCCCGGAAACAGCGAAGGGAGAGGACGACATTTACTAG
  GGCACAGCTCGACGTTCTGGAAGCTCTGTTTGCCAAGACCCGGTACCCAGACATCTTCATGAGGGAAGAG
  GTGGCACTGAAAATCAACTTGCCAGAATCCAGGGTGCAGGTATGGTTTAAGAATCGAAGAGCTAAGTGCC
  GCCAACAGCAGCAGCAGCAGCAGAATGGAGGTCAGAACAAAGTGAGGCCTGCCAAGAAGAAGAGCTCTCC
  AGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAGTTCAGTCCCCCCTCTAGTACCTCAGTCCCA
  ACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTGGAGCCCAGCGTCCATCTCCCCACTGTCTGACCCCT
  TGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTATCCCATGACCTATACTCAGGCTTCAGGTTATAGTCA
  AGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCATGGACTGTGGATCTTATTTGACCCCTATGCATCAC
  CAGCTTCCTGGACCAGGGGCCACACTCAGTCCCATGGGTACCAATGCTGTTACCAGCCATCTCAATCAGT
  CCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCTTCAAGCTTGGGTTTTAACTCAACCACTGATTGCTT
  GGATTATAAGGACCAAACTGCCTCTTGGAAGCTTAACTTCAATGCTGACTGCTTGGATTATAAAGATCAG
  ACGTCCTCATGGAAATTCCAGGTTTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_144841
• ORF Size: 870 bp
• Insert Size: 870
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC017609, AAH17609
• RefSeq Size: 1737
• RefSeq ORF: 870
• Locus ID: 18424
• Gene Summary: This gene encodes a protein that belongs to the homeobox family of transcription factors. The encoded protein plays a role in the development and patterning of the head. This protein regulates development of the choroid plexuses in the brain affecting composition of cerebrospinal fluid in the developing brain and is thought to function in the development of sense organs in the embryo. In humans, mutations in this gene are associated with pituitary hormone deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform b) is shorter than isoform a. Variants 2, 3 and 4 encode the same protein.