Rab18 (NM_181070) Mouse Untagged Clone

CAT#: MC207371

Rab18 (untagged) - Mouse RAB18, member RAS oncogene family (Rab18), (10ug)


  "NM_181070" in other vectors (3)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rab18"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rab18
Synonyms AA959686
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207371 representing NM_181070
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGGACGTGCTGACCACTCTGAAGATACTCATCATCGGCGAGAGTGGGGTGGGCAAGTCCAGCC
TGCTCCTGAGGTTCACAGATGATACCTTTGATCCAGAACTTGCAGCAACAATAGGTGTTGACTTTAAGGT
GAAAACGATTTCAGTGGATGGAAATAAGGCTAAACTTGCAATATGGGATACAGCTGGTCAAGAGAGGTTC
AGAACATTAACTCCCAGCTATTATAGAGGTGCACAGGGAGTTATATTAGTCTATGATGTCACAAGAAGAG
ACACCTTTGTTAAACTGGATAACTGGTTAAATGAATTGGAAACATACTGTACAAGAAATGACATAGTAAA
CATGCTAGTTGGAAATAAAATTGATAAGGAAAACCGTGAAGTCGATAGAAATGAAGGCTTGAAATTTGCA
CGCAAGCATTCTATGTTGTTCATAGAGGCAAGTGCAAAAACCTGTGATGGTGTACAGTGTGCCTTTGAGG
AGCTTGTTGAGAAGATCATTCAGACACCTGGCCTGTGGGAAAGTGAGAACCAGAACAAAGGAGTCAAGCT
GTCACACAGGGAAGAGAGCCGCGGAGGAGGCGCCTGCGGCGGTTACTGCTCTGTGCTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_181070
ORF Size 621 bp
Insert Size 621
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_181070.6, NP_851415.1
RefSeq Size 3670
RefSeq ORF 621
Locus ID 19330
Gene Summary This gene encodes a member of the Ras-related small GTPases, which regulate membrane trafficking in organelles and transport vesicles. This protein is expressed predominantly in lipid droplets, organelles that store neutral lipids, and is proposed to play a role in lipolysis and lipogenesis. In humans mutations in this gene are associated with Warburg micro syndrome type 3. A pseudogene of this gene is located on chromosome X. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.