Ier3ip1 (NM_025409) Mouse Untagged Clone

CAT#: MC207568

Ier3ip1 (untagged) - Mouse immediate early response 3 interacting protein 1 (Ier3ip1), (10ug)


  "NM_025409" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ier3ip1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ier3ip1
Synonyms 1110057H19Rik; AI644142; AL022842; AL022863; AV026606
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207568 representing NM_025409
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTTCACGCTGTACTCCCTGATGCAGGCGGCCCTGCTGTGCGTGAACGCCATCGCCGTGCTGCACG
AGGAGCGCTTCCTCAAGAACATTGGCTGGGGAACAGACCAGGGAATCGGTGGATTTGGAGAGGAGCCAGG
AATTAAATCTCAACTAATGAACCTTATTCGGTCTGTAAGAACCGTGATGAGAGTGCCATTGATAATAGTA
AACTCAATTACTATTGTATTGCTTCTGTTATTTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025409
ORF Size 249 bp
Insert Size 249
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_025409.3, NP_079685.1
RefSeq Size 1404
RefSeq ORF 249
Locus ID 66191

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.