Rplp2 (NM_026020) Mouse Untagged Clone

CAT#: MC207613

Rplp2 (untagged) - Mouse ribosomal protein, large P2 (Rplp2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rplp2
• Synonyms: 2700049I22Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207613 representing NM_026020
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCGCTACGTCGCCTCTTACCTGCTGGCCGCCCTCGGGGGCAACTCCTCTCCTAGCGCCAAAGACATCA
  AGAAAATACTAGACAGCGTGGGCATCGAAGCGGACGATGATCGGCTCAACAAGGTCATCAGTGAGCTGAA
  TGGAAAGAACATTGAGGATGTCATCGCTCAGGGTGTTGGCAAGCTGGCCAGTGTGCCTGCTGGTGGGGCT
  GTGGCTGTTTCTGCTGCCCCTGGCTCTGCAGCACCTGCTGCTGGTTCTGCCCCCGCTGCAGCAGAGGAGA
  AGAAAGATGAGAAGAAGGAGGAGTCCGAGGAGTCGGATGACGACATGGGATTTGGCTTGTTTGATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_026020
• ORF Size: 348 bp
• Insert Size: 348
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_026020.6, NP_080296.3
• RefSeq Size: 441
• RefSeq ORF: 348
• Locus ID: 67186
• Gene Summary: Plays an important role in the elongation step of protein synthesis. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.