Apoa2 (NM_013474) Mouse Untagged Clone

CAT#: MC208135

Apoa2 (untagged) - Mouse apolipoprotein A-II (Apoa2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Apoa2
• Synonyms: Alp-2; Apo-AII; Apoa-2; ApoA-II; ApoAII; Hdl-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208135 representing NM_013474
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGAC
  AGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGA
  TTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAG
  CAGCTGACACCCCTTGTCAGGTCAGCAGGAACTAGTCTGGTGAACTTCTTCAGCAGTTTAATGAACCTTG
  AGGAGAAACCGGCTCCTGCGGCTAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013474
• ORF Size: 309 bp
• Insert Size: 309
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013474.2, NP_038502.2
• RefSeq Size: 521
• RefSeq ORF: 309
• Locus ID: 11807
• Gene Summary: This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (1) encodes the functional protein. Variants 1, 2, 3 and 4 encode the same protein.