Hrk (NM_007545) Mouse Untagged Clone

CAT#: MC208189

Hrk (untagged) - Mouse harakiri, BCL2 interacting protein (contains only BH3 domain) (Hrk), (10ug)


  "NM_007545" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hrk
Synonyms AI838259; Bid3; DP5; harakiri
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208189 representing NM_007545
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCCCGTGTCCCCGGCATCGCGGCCGCGGGCCCCCGGCCGTGTGCGGTTGCGGCGACGCTCGCCCCG
GGCTGCGCTGGGCGGCGGCGCAGGTGACCGCGCTGCGGCTGCAGGCGCTGGGCGACGAGCTGCACCGACG
CGCCATGCGGCGTCGCGCGCGGCCCCGGGACCCGCTGCCCGCGCTGCTGCCCGCGCTCCGCGCCCGCTGG
CCCTGGCTGTGCGCGGCCGCGCAGGTGGCGGCGCTGGCGGCCTGGCTGCTCGGCAGGCGGAGCGCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007545
ORF Size 279 bp
Insert Size 279
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007545.2, NP_031571.1
RefSeq Size 5366
RefSeq ORF 279
Locus ID 12123

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.