Btc (NM_007568) Mouse Untagged Clone

CAT#: MC208202

Btc (untagged) - Mouse betacellulin, epidermal growth factor family member (Btc), (10ug)


  "NM_007568" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Btc
Synonyms Bcn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208202 representing NM_007568
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCAACAGCCCCGGGTAGCAGTGTCAGCTCCCTGCCGCTGCTCCTGGTCCTTGCCCTGGGTCTTG
CAATTCTCCACTGTGTGGTAGCAGATGGGAACACAACCAGAACACCAGAAACCAATGGCTCTCTTTGTGG
AGCTCCTGGGGAAAACTGCACAGGTACCACCCCTAGACAGAAAGTGAAAACCCACTTCTCTCGGTGCCCC
AAGCAGTACAAGCATTACTGCATCCATGGGAGATGCCGCTTCGTGGTGGACGAGCAAACTCCCTCCTGCA
TCTGTGAGAAAGGCTACTTTGGGGCTCGGTGTGAGCGAGTGGACCTGTTTTACCTCCAGCAGGACCGGGG
GCAGATCCTGGTGGTCTGCTTGATAGTGGTCATGGTGGTGTTCATCATTTTAGTCATCGGCGTCTGCACC
TGCTGTCATCCTCTTCGGAAACATCGTAAAAAAAAGAAGGAAGAGAAAATGGAGACTTTGGATAAAGATA
AAACTCCCATAAGTGAAGATATTCAAGAGACCAATATTGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007568
ORF Size 534 bp
Insert Size 534
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007568.5, NP_031594.1
RefSeq Size 2876
RefSeq ORF 534
Locus ID 12223
Gene Summary This gene encodes a member of the epidermal growth factor (EGF) family. These growth factors are ligands for the EGFR/ErbB receptor tyrosine kinases, and play roles in cell growth and differentiation. The encoded protein is synthesized as a transmembrane precursor that is proteolytically cleaved to generate a mature peptide, and plays a role in the differentiation of pancreatic beta cells. This gene may also play a protective role in acute pancreatitis, whereas increased expression of this gene may contribute to diabetic macular edema. Gene therapy using combinations of this gene and other pancreas-specific transcription factors may induce islet neogenesis and remediate hyperglycemia in type 1 diabetes. [provided by RefSeq, Apr 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.