Cldn4 (NM_009903) Mouse Untagged Clone

CAT#: MC208287

Cldn4 (untagged) - Mouse claudin 4 (Cldn4), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cldn4
• Synonyms: Cep-r; Cpetr; Cpetr1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208287 representing NM_009903
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGTCTATGGGACTACAGGTCCTGGGAATCTCCTTGGCAGTCCTGGGCTGGCTGGGGATCATCCTGA
  GTTGTGCGCTCCCCATGTGGCGGGTGACCGCCTTCATCGGCAGCAACATCGTCACGGCACAGACCAGCTG
  GGAGGGCCTCTGGATGAACTGCGTGGTGCAGAGCACAGGTCAGATGCAGTGCAAGATGTACGACTCGATG
  CTCGCCCTGCCGCAGGACCTGCAGGCCGCCCGAGCCCTTATGGTCATCAGCATCATCGTGGGTGCTCTGG
  GGATGCTTCTCTCAGTGGTAGGGGGCAAGTGCACCAACTGCATGGAGGACGAGACCGTCAAGGCCAAGAT
  CATGATCACCGCCGGAGCCGTGTTCATCGTGGCAAGCATGCTGATTATGGTGCCCGTGTCCTGGACCGCT
  CACAACGTCATCCGCGACTTCTACAACCCTATGGTGGCTTCCGGGCAGAAGAGGGAAATGGGGGCCTCGC
  TTTACGTCGGCTGGGCGGCCTCCGGGCTGCTGCTCCTGGGAGGAGGCCTCCTCTGCTGCAGTTGCCCACC
  TCGTAGCAACGACAAGCCCTACTCGGCCAAGTACTCCGCCGCCCGCTCTGTCCCCGCCAGCAACTATGTG
  TAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009903
• ORF Size: 633 bp
• Insert Size: 633
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_009903.2, NP_034033.1
• RefSeq Size: 1827
• RefSeq ORF: 633
• Locus ID: 12740
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a high-affinity receptor for clostridium perfringens enterotoxin (CPE) produced by the bacterium Clostridium perfringens, and the interaction with CPE results in increased membrane permeability by forming small pores in plasma membrane. This protein augments alveolar epithelial barrier function and is induced in acute lung injury. It is highly expressed in pancreatic and ovarian cancers. [provided by RefSeq, Aug 2010]