Epo (NM_007942) Mouse Untagged Clone

CAT#: MC208445

Epo (untagged) - Mouse erythropoietin (Epo), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Epo
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208445 representing NM_007942
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGGTGCCCGAACGTCCCACCCTGCTGCTTTTACTCTCCTTGCTACTGATTCCTCTGGGCCTCCCAG
  TCCTCTGTGCTCCCCCACGCCTCATCTGCGACAGTCGAGTTCTGGAGAGGTACATCTTAGAGGCCAAGGA
  GGCAGAAAATGTCACGATGGGTTGTGCAGAAGGTCCCAGACTGAGTGAAAATATTACAGTCCCAGATACC
  AAAGTCAACTTCTATGCTTGGAAAAGAATGGAGGTGGAAGAACAGGCCATAGAAGTTTGGCAAGGCCTGT
  CCCTGCTCTCAGAAGCCATCCTGCAGGCCCAGGCCCTGCTAGCCAATTCCTCCCAGCCACCAGAGACCCT
  TCAGCTTCATATAGACAAAGCCATCAGTGGTCTACGTAGCCTCACTTCACTGCTTCGGGTACTGGGAGCT
  CAGAAGGAATTGATGTCGCCTCCAGATACCACCCCACCTGCTCCACTCCGAACACTCACAGTGGATACTT
  TCTGCAAGCTCTTCCGGGTCTACGCCAACTTCCTCCGGGGGAAACTGAAGCTGTACACGGGAGAGGTCTG
  CAGGAGAGGGGACAGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_007942
• ORF Size: 579 bp
• Insert Size: 579
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC119265, AAI19266
• RefSeq Size: 715
• RefSeq ORF: 579
• Locus ID: 13856
• Gene Summary: This gene encodes the glycoprotein hormone erythropoietin that regulates the production of red blood cells and biosynthesis of hemoglobin. The predominant expression of this gene shifts from the liver during fetal development to kidney in adults. A complete lack of the encoded protein causes embryonic lethal anemia in mice. The conditional inactivation of this gene in adult mice results in a chronic, normocytic and normochromic anemia. Transgenic mice expressing the human ortholog of this gene exhibit polycythemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).