Fas (NM_001146708) Mouse Untagged Clone

CAT#: MC208466

Fas (untagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas), transcript variant 2, (10ug)


  "NM_001146708" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fas
Synonyms AI196731; APO1; APT1; CD95; lpr; TNFR6; Tnfrsf6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208466 representing NM_001146708
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGTGGATCTGGGCTGTCCTGCCTCTGGTGCTTGCTGGCTCACAGTTAAGAGTTCATACTCAAGGTA
CTAATAGCATCTCCGAGAGTTTAAAGCTGAGGAGGCGGGTTCGTGAAACTGATAAAAACTGCTCAGAAGG
ATTATATCAAGGAGGCCCATTTTGCTGTCAACCATGCCAACCTGAAAACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001146708
ORF Size 192 bp
Insert Size 192
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001146708.1, NP_001140180.1
RefSeq Size 555
RefSeq ORF 192
Locus ID 14102

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.