Gdnf (NM_010275) Mouse Untagged Clone

CAT#: MC208539

Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gdnf
• Synonyms: AI385739; ATF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208539 representing NM_010275
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGATTCGGGCCACTTGGAGTTAATGTCCAACTGGGGGTCTACGGAGACCGGATCCGAGGTGCCGCCG
  CCGGACGGGACTCTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTC
  TGCCTTCCCGCTGCCCGCCGGTAAGAGGCTTCTCGAAGCGCCCGCTGAAGACCACTCCCTCGGCCACCGC
  CGCGTGCCCTTCGCGCTGACCAGTGACTCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCA
  TGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCG
  AAGAGAGAGGAATCGGCAGGCTGCAGCTGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAG
  AGGGGCAAAAATCGGGGGTGCGTTTTAACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATG
  AAACCAAGGAGGAACTGATCTTTCGATATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAA
  AATACTAAAAAACCTGTCTCGGAGTAGAAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCG
  GTCGCCTTCGACGACGACCTGTCGTTTTTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCG
  CTAAACGGTGTGGATGTATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010275
• ORF Size: 723 bp
• Insert Size: 723
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC119031, AAI19032
• RefSeq Size: 4477
• RefSeq ORF: 723
• Locus ID: 14573
• Gene Summary: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.