Ghrh (NM_010285) Mouse Untagged Clone

CAT#: MC208549

Ghrh (untagged) - Mouse growth hormone releasing hormone (Ghrh), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ghrh
• Synonyms: Ghrf; GRF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208549 representing NM_010285
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGCTCTGGGTGCTCTTTGTGATCCTCATCCTCACCAGTGGCTCCCACTGCTCACTGCCCCCCTCAC
  CTCCCTTCAGGATGCAGCGACACGTAGATGCCATCTTCACCACCAACTACAGGAAACTCCTGAGCCAGCT
  GTATGCCCGGAAAGTGATCCAGGACATCATGAACAAGCAAGGGGAGAGGATCCAGGAACAAAGGGCCAGG
  CTCAGCCGCCAGGAAGACAGCATGTGGACAGAGGACAAGCAGATGACCCTGGAGAGCATCTTGCAGGGAT
  TCCCAAGGATGAAGCCTTCAGCGGACGCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010285
• ORF Size: 312 bp
• Insert Size: 312
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_010285.2, NP_034415.1
• RefSeq Size: 534
• RefSeq ORF: 312
• Locus ID: 14601
• Gene Summary: This gene encodes a hormone that has stimulatory effects on pituitary growth hormone synthesis and release, and somatotrope expansion. The encoded preproprotein undergoes proteolytic processing to generate the mature peptide that is secreted by hypothalamus. Mice lacking the encoded protein are deficient in the growth hormone, live longer and exhibit growth retardation, enhanced insulin sensitivity and increased xenobiotic metabolism. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Both variants 1 and 2 encode the same protein.