Cxcl1 (NM_008176) Mouse Untagged Clone

CAT#: MC208599

Cxcl1 (untagged) - Mouse chemokine (C-X-C motif) ligand 1 (Cxcl1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cxcl1
• Synonyms: Fsp; gro; Gro1; KC; Mgsa; N51; Scyb1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208599 representing NM_008176
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAG
  GGGCGCCTATCGCCAATGAGCTGCGCTGTCAGTGCCTGCAGACCATGGCTGGGATTCACCTCAAGAACAT
  CCAGAGCTTGAAGGTGTTGCCCTCAGGGCCCCACTGCACCCAAACCGAAGTCATAGCCACACTCAAGAAT
  GGTCGCGAGGCTTGCCTTGACCCTGAAGCTCCCTTGGTTCAGAAAATTGTCCAAAAGATGCTAAAAGGTG
  TCCCCAAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008176
• ORF Size: 291 bp
• Insert Size: 291
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC132502, AAI32503
• RefSeq Size: 964
• RefSeq ORF: 291
• Locus ID: 14825
• Gene Summary: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung. [provided by RefSeq, Apr 2013]