Hcrt (NM_010410) Mouse Untagged Clone

CAT#: MC208652

Hcrt (untagged) - Mouse hypocretin (Hcrt), (10ug)


  "NM_010410" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hcrt"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hcrt
Synonyms PPOX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208652 representing NM_010410
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTTTCCTTCTACAAAGGTTCCCTGGGCCGCCGTGACGCTGCTGCTGCTGCTACTGCTGCCGCCGG
CGCTGCTGTCGCTTGGGGTGGACGCACAGCCTCTGCCCGACTGCTGTCGCCAGAAGACGTGTTCCTGCCG
TCTCTACGAACTGTTGCACGGAGCTGGCAACCACGCTGCGGGTATCCTGACTCTGGGAAAGCGGCGGCCT
GGACCTCCAGGCCTCCAGGGACGGCTGCAGCGCCTCCTTCAGGCCAACGGTAACCACGCAGCTGGCATCC
TGACCATGGGCCGCCGCGCAGGCGCAGAGCTAGAGCCACATCCCTGCTCTGGTCGCGGCTGTCCGACCGT
AACTACCACCGCTTTAGCACCCCGGGGAGGGTCCGGAGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010410
ORF Size 393 bp
Insert Size 393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_010410.2, NP_034540.1
RefSeq Size 584
RefSeq ORF 393
Locus ID 15171
Gene Summary This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors Hcrtr1 and Hcrtr2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.