Ifng (NM_008337) Mouse Untagged Clone

CAT#: MC208752

Ifng (untagged) - Mouse interferon gamma (Ifng), (10ug)


  "NM_008337" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ifng"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ifng
Synonyms Ifg; IFN-g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208752 representing NM_008337
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGCTACACACTGCATCTTGGCTTTGCAGCTCTTCCTCATGGCTGTTTCTGGCTGTTACTGCCACG
GCACAGTCATTGAAAGCCTAGAAAGTCTGAATAACTATTTTAACTCAAGTGGCATAGATGTGGAAGAAAA
GAGTCTCTTCTTGGATATCTGGAGGAACTGGCAAAAGGATGGTGACATGAAAATCCTGCAGAGCCAGATT
ATCTCTTTCTACCTCAGACTCTTTGAAGTCTTGAAAGACAATCAGGCCATCAGCAACAACATAAGCGTCA
TTGAATCACACCTGATTACTACCTTCTTCAGCAACAGCAAGGCGAAAAAGGATGCATTCATGAGTATTGC
CAAGTTTGAGGTCAACAACCCACAGGTCCAGCGCCAAGCATTCAATGAGCTCATCCGAGTGGTCCACCAG
CTGTTGCCGGAATCCAGCCTCAGGAAGCGGAAAAGGAGTCGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008337
ORF Size 468 bp
Insert Size 468
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC119063, AAI19064
RefSeq Size 958
RefSeq ORF 468
Locus ID 15978
Gene Summary This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mice deficient in this gene have increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.