Il10 (NM_010548) Mouse Untagged Clone

CAT#: MC208764

Il10 (untagged) - Mouse interleukin 10 (Il10), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Il10
• Synonyms: CSIF; Il-10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208764 representing NM_010548
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCTGGCTCAGCACTGCTATGCTGCCTGCTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACA
  GCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGC
  CTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTA
  ATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAG
  TGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAA
  GACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAG
  CAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCT
  TCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010548
• ORF Size: 537 bp
• Insert Size: 537
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC120612, AAI20613
• RefSeq Size: 1306
• RefSeq ORF: 537
• Locus ID: 16153
• Gene Summary: This gene encodes an anti-inflammatory cytokine that is a member of the class-2 cytokine family. The encoded protein is secreted by cells of both the innate and adaptive immune systems and is crucial for limiting the immune response to a broad range of pathogens. It also has been shown to suppress autoimmune responses. This protein mediates it's immunosuppressive signal through a specific interleukin 10 receptor complex. Aberrant functioning of this gene is associated with numerous immune disorders including graft-versus-host disease, and increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, Sep 2015]