Il10 (NM_010548) Mouse Tagged ORF Clone
CAT#: MR227034
- TrueORF®
Il10 (Myc-DDK-tagged) - Mouse interleukin 10 (Il10)
"NM_010548" in other vectors (4)
Interest in protein/lysate? Submit request here!
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | Il10 |
Synonyms | CSIF; Il-10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR227034 representing NM_010548
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTGGCTCAGCACTGCTATGCTGCCTGCTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACA GCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGC CTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTA ATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAG TGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAA GACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAG CAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCT TCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_010548 |
ORF Size | 534 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010548.1, NM_010548.2, NP_034678.1 |
RefSeq Size | 1306 bp |
RefSeq ORF | 537 bp |
Locus ID | 16153 |
Cytogenetics | 1 56.89 cM |
MW | 21.1 kDa |
Gene Summary | This gene encodes an anti-inflammatory cytokine that is a member of the class-2 cytokine family. The encoded protein is secreted by cells of both the innate and adaptive immune systems and is crucial for limiting the immune response to a broad range of pathogens. It also has been shown to suppress autoimmune responses. This protein mediates it's immunosuppressive signal through a specific interleukin 10 receptor complex. Aberrant functioning of this gene is associated with numerous immune disorders including graft-versus-host disease, and increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC208764 | Il10 (untagged) - Mouse interleukin 10 (Il10), (10ug) |
USD 540.00 |
|
MG227034 | Il10 (GFP-tagged) - Mouse interleukin 10 (Il10), (10ug) |
USD 460.00 |
|
MR227034L3 | Lenti ORF clone of Il10 (Myc-DDK-tagged) - Mouse interleukin 10 (Il10) |
USD 620.00 |
|
MR227034L4 | Lenti ORF clone of Il10 (mGFP-tagged) - Mouse interleukin 10 (Il10) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review