Il5 (NM_010558) Mouse Untagged Clone

CAT#: MC208784

Il5 (untagged) - Mouse interleukin 5 (Il5), (10ug)


  "NM_010558" in other vectors (4)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Il5
Synonyms Il-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208784 representing NM_010558
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAAGGATGCTTCTGCACTTGAGTGTTCTGACTCTCAGCTGTGTCTGGGCCACTGCCATGGAGATTC
CCATGAGCACAGTGGTGAAAGAGACCTTGACACAGCTGTCCGCTCACCGAGCTCTGTTGACAAGCAATGA
GACGATGAGGCTTCCTGTCCCTACTCATAAAAATCACCAGCTATGCATTGGAGAAATCTTTCAGGGGCTA
GACATACTGAAGAATCAAACTGTCCGTGGGGGTACTGTGGAAATGCTATTCCAAAACCTGTCATTAATAA
AGAAATACATTGACCGCCAAAAAGAGAAGTGTGGCGAGGAGAGACGGAGGACGAGGCAGTTCCTGGATTA
CCTGCAAGAGTTCCTTGGTGTGATGAGTACAGAGTGGGCAATGGAAGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010558
ORF Size 402 bp
Insert Size 402
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_010558.1, NP_034688.1
RefSeq Size 1534
RefSeq ORF 402
Locus ID 16191
Gene Summary Factor that induces terminal differentiation of late-developing B-cells to immunoglobulin secreting cells. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.