Nppc (NM_010933) Mouse Untagged Clone

CAT#: MC209051

Nppc (untagged) - Mouse natriuretic peptide type C (Nppc), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nppc
• Synonyms: CNP; lbab
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209051 representing NM_010933
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCACCTCTCCCAGCTGATCGCCTGCGCCCTGCTGCTCGCGCTACTCTCGCTCCGGCCCTCTGAAGCCA
  AGCCCGGGACACCACCGAAGGTCCCGAGAACCCCGCCAGGGGAGGAGCTGGCGGATTCCCAGGCAGCTGG
  TGGCAATCAGAAAAAGGGTGACAAGACTCCAGGCAGCGGGGGAGCCAATCTCAAGGGAGACCGATCGCGA
  CTGCTCCGGGACCTGCGTGTGGACACCAAGTCCCGGGCTGCTTGGGCCCGCCTTCTGCACGAGCACCCCA
  ACGCGCGCAAATACAAAGGCGGCAACAAGAAGGGCTTGTCCAAAGGCTGCTTTGGCCTCAAGCTGGACCG
  GATCGGCTCCATGAGCGGTCTGGGATGTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010933
• ORF Size: 381 bp
• Insert Size: 381
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_010933.5, NP_035063.1
• RefSeq Size: 1042
• RefSeq ORF: 381
• Locus ID: 18159
• Gene Summary: This gene encodes a member of the natriuretic peptide family. Natriuretic peptides are involved in the control of blood pressure, extracellular fluid volume and electrolyte homeostasis. The encoded protein also plays a role in sensory neuron bifurcation, and is a critical regulator of endochondral bone growth. The encoded protein is a ligand for the natriuretic peptide receptor B, and is synthesized as a preprohormone which is cleaved to produce a mature peptide. Mutations in this gene are associated with dwarfism resulting from impaired endochondral ossification. [provided by RefSeq, Apr 2011]