Pdyn (NM_018863) Mouse Untagged Clone

CAT#: MC209161

Pdyn (untagged) - Mouse prodynorphin (Pdyn), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pdyn
• Synonyms: Dyn
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209161 representing NM_018863
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_018863
• ORF Size: 747 bp
• Insert Size: 747
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_018863.3, NP_061351.2
• RefSeq Size: 747
• RefSeq ORF: 747
• Locus ID: 18610
• Gene Summary: This gene encodes a preproprotein that is proteolytically cleaved to yield a number of active opium-like peptides. These peptides are the endogenous ligands for the Kappa-opioid receptor and similar G-protein-coupled receptors and are thought to function as the body's natural way to control addiction. These peptides have been associated with depression, stress, anxiety, response to pain, and maintenance of homeostasis via circadian rhythms and control of appetite. Mutations in the related human gene have been linked to the neurodegenerative disease spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.