Tac1 (NM_009311) Mouse Untagged Clone

CAT#: MC209491

Tac1 (untagged) - Mouse tachykinin 1 (Tac1), (10ug)


  "NM_009311" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tac1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tac1
Synonyms 4930528L02Rik; NK-1; NK1; Nkna; PPT-A; PPTA; SP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209491 representing NM_009311
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAATCCTCGTGGCCGTGGCGGTCTTTTTTCTCGTTTCCACTCAACTGTTTGCAGAGGAAATCGATG
CCAACGATGATCTAAATTATTGGTCCGACTGGTCCGACAGTGACCAGATCAAGGAGGCAATGCCGGAGCC
CTTTGAGCATCTTCTGCAGAGAATCGCCCGAAGACCCAAGCCTCAGCAGTTCTTTGGATTAATGGGCAAG
CGGGATGCTGATTCCTCAGTTGAAAAACAAGTGGCCCTGTTAAAGGCTCTTTATGGACATGGCCAGATCT
CTCACAAAAGGCATAAAACAGATTCCTTTGTTGGACTAATGGGCAAAAGAGCTTTAAATTCTGTGGCTTA
TGAAAGAAGCGCGATGCAGAACTACGAAAGAAGACGTAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009311
ORF Size 393 bp
Insert Size 393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009311.2, NP_033337.1
RefSeq Size 1034
RefSeq ORF 393
Locus ID 21333
Gene Summary Tachykinins are active peptides which excite neurons, evoke behavioral responses, are potent vasodilators and secretagogues, and contract (directly or indirectly) many smooth muscles. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.