Twist1 (NM_011658) Mouse Untagged Clone

CAT#: MC209601

Twist1 (untagged) - Mouse twist homolog 1 (Drosophila) (Twist1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Twist1
• Synonyms: bHLHa38; M-Twist; Pde; pdt; Ska10; Ska; Twist
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209601 representing NM_011658
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGCAGGACGTGTCCAGCTCGCCAGTCTCTCCGGCCGACGACAGCCTGAGCAACAGCGAGGAGGAGC
  CGGACCGGCAGCAGCCGGCGAGCGGCAAGCGCGGGGCTCGCAAGAGACGCAGCAGTCGGCGCAGCGCGGG
  CGGCAGCGCGGGGCCCGGCGGGGCCACGGGCGGGGGCATCGGAGGCGGCGACGAGCCAGGCAGCCCGGCC
  CAGGGCAAGCGCGGCAAGAAATCTGCGGGCGGAGGCGGCGGCGGCGGCGCGGGCGGAGGTGGTGGCGGCG
  GCGGCGGCAGCAGCAGCGGGGGCGGGAGCCCGCAGTCGTACGAGGAGCTGCAGACCCAGCGGGTCATGGC
  TAACGTGCGGGAGCGCCAGCGCACGCAGTCGCTGAACGAGGCGTTCGCCGCCCTGCGCAAGATCATCCCC
  ACGCTGCCCTCGGACAAGCTGAGCAAGATTCAGACCCTCAAACTGGCGGCCAGGTACATCGACTTCCTGT
  ACCAGGTCCTGCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCT
  CAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011658
• ORF Size: 621 bp
• Insert Size: 621
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC083139, AAH83139
• RefSeq Size: 1665
• RefSeq ORF: 621
• Locus ID: 22160
• Gene Summary: Basic helix-loop-helix (bHLH) transcription factors have been implicated in cell lineage determination and differentiation. This gene encodes a bHLH transcription factor that is evolutionarily conserved from invertebrates to humans, and was originally identified in Drosophila as an essential gene involved in early mesoderm development and dorsal-ventral patterning in the embryo. This protein plays a role in cancer by regulating the epithelial-mesenchymal transition (EMT), a process that is critical for metastasis initiation, and promoting tumor progression. Mutations in the human gene are associated with Saethre-Chotzen syndrome (SCS). Mice with heterozygous mutations in this gene exhibit cranofacial and structural defects similar to those seen in human SCS patients. [provided by RefSeq, Sep 2015]