Vip (NM_011702) Mouse Untagged Clone

CAT#: MC209641

Vip (untagged) - Mouse vasoactive intestinal polypeptide (Vip), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vip
• Synonyms: MGC107202
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209641 representing NM_011702
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGCCAGAAGCAAGCCTCAGTTCCTGGCATTCCTGATACTCTTCAGTGTGCTGTTCTCTCAGTCGC
  TGGCCTGGCCTCTCTTTGGACCACCTTCTGTAGTGAGTAGGCTGGATGACAGGATGCCGTTTGAAGGAGC
  AGGTGACCCTGACCAAGTCTCTTTAAAAGCAGACTCTGACATCTTGCAGAATCCCTTAGCAGAAAATGGC
  ACACCCTATTATGATGTGTCAAGAAATGCCAGGCATGCTGATGGAGTTTTCACCAGCGATTACAGCAGAC
  TTCTGGGTCAGATTTCTGCCAAAAAATACCTTGAGTCACTCATTGGCAAACGAATCAGCAGCAGCATCTC
  GGAAGATCCTGTGCCAATCAAACGACACTCTGATGCCGTCTTCACAGATAACTACACCCGCCTCAGAAAG
  CAAATGGCTGTGAAGAAATACCTGAACTCCATCCTGAATGGAAAGAGGAGCAGTGAGGGAGATTCTGCAG
  ACTTTCTTGAAGAGCTGGAGAAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011702
• ORF Size: 516 bp
• Insert Size: 516
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC089511, AAH89511
• RefSeq Size: 1466
• RefSeq ORF: 516
• Locus ID: 22353
• Gene Summary: This gene encodes a neuropeptide of the glucagon/secretin superfamily with potent bronchodilator, immunomodulator and anti-inflammatory properties. The encoded protein is proteolytically processed to generate two structurally similar neuropeptides - vasoactive intestinal peptide (VIP) and peptide histidine isoleucine (PHI). In the digestive tract, VIP stimulates relaxation of enteric smooth muscle, secretion of water and electrolytes, release of insulin and glucagon, and inhibition of gastric acid secretion. In the cardiovascular system, VIP causes coronary vasodilation and stimulates contractility in the heart. Mice lacking VIP exhibit airway hyperresponsiveness and airway inflammation. Male mice lacking VIP exhibit moderate pulmonary arterial hypertension resulting in increased mortality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).