Uts2 (NM_011910) Mouse Untagged Clone

CAT#: MC209702

Uts2 (untagged) - Mouse urotensin 2 (Uts2), (10ug)


  "NM_011910" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Uts2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Uts2
Synonyms prepro-UII; Ucn2; UII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209702 representing NM_011910
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAGGGTGCCCTTCTGCTGCCTGCTCTTCATAGGACTTCTGAATCCACTGCTGTCCCTTCCCGTCA
CGGACACTGGTGAGAGGACTCTTCAGCTTCCAGTGCTTGAGGAAGACGCTCTTCGGGCTCTGGAGGAGCT
GGAGAGGATGGCCCTCCTGCAGACCCTGCGTCAGACCATGGGCACGGAAGCAGGGGAGAGCCCTGGAGAA
GCAGGTCCCAGCACTGAGACTCCCACTCCACGGGGAAGCATGAGGAAGGCTTTCGCTGGGCAAAATTCTA
ACACTGTACTGAGTCGTCTCTTGGCAAGAACCAGGAAACAACATAAGCAACACGGGGCTGCCCCAGAGTG
CTTCTGGAAATACTGCATTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011910
ORF Size 372 bp
Insert Size 372
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011910.2, NP_036040.1
RefSeq Size 538
RefSeq ORF 372
Locus ID 24111
Gene Summary This gene encodes a member of the urotensin family of peptide hormones. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone before secretion into the plasma. Mice lacking the encoded protein have a significantly decreased low density lipoprotein cholesterol profile and hepatic steatosis that is consistent with decreased hepatocyte de novo cholesterol synthesis and apolipoprotein B secretion. [provided by RefSeq, Sep 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.