Timm10 (NM_013899) Mouse Untagged Clone

CAT#: MC209833

Timm10 (untagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_013899" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Timm10"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Timm10
Synonyms Tim13; Timm13a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209833 representing NM_013899
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCCGCTCAGAGCCCAGCAGCTGGCTGCGGAGCTGGAGGTGGAGATGATGGCTGACATGTACAACA
GAATGACCAGTGCCTGCCACCGGAAGTGCGTGCCTCCCCACTACAAGGAGGCAGAGCTGTCCAAAGGCGA
GTCTGTGTGTCTGGACCGATGTGTATCCAAGTACTTGGACATCCATGAGAGGATGGGCAAAAAGTTGACA
GAGCTGTCAATGCAGGATGAGGAGCTGATGAAGAGGGTACAGCAGAGCTCGGGGCCTGCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013899
ORF Size 273 bp
Insert Size 273
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013899.2, NP_038927.2
RefSeq Size 682
RefSeq ORF 273
Locus ID 30059

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.