Prdx5 (NM_012021) Mouse Untagged Clone

CAT#: MC209991

Prdx5 (untagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prdx5
• Synonyms: AOEB166; AOPP; PLP; Pmp20; Prdx6; PrxV
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209991 representing NM_012021
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGG
  CAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGT
  GACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAG
  AAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACAC
  CTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCA
  GGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAA
  GGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATT
  CTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAA
  GGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTC
  TGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012021
• ORF Size: 633 bp
• Insert Size: 633
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC008174, AAH08174
• RefSeq Size: 1218
• RefSeq ORF: 633
• Locus ID: 54683
• Gene Summary: This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites may result in use of alternate in-frame translation start codons that generate alternate isoforms that are targeted to the mitochondrion or peroxisome/cytoplasm. [provided by RefSeq, Nov 2017]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).