Hamp (NM_032541) Mouse Untagged Clone

CAT#: MC211974

Hamp (untagged) - Mouse hepcidin antimicrobial peptide (Hamp), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hamp
• Synonyms: Hamp1; Hepc; Hepc1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032541, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACTCAGCACTCGGACCCAGGCTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCACCA
  CCTATCTCCATCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGAAAGCAGGGCAGA
  CATTGCGATACCAATGCAGAAGAGAAGGAAGAGAGACACCAACTTCCCCATCTGCATCTTCTGCTGTAAA
  TGCTGTAACAATTCCCAGTGTGGTATCTGTTGCAAAACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032541
• ORF Size: 252 bp
• Insert Size: 252
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC021587, AAH21587
• RefSeq Size: 393
• RefSeq ORF: 252
• Locus ID: 84506
• Gene Summary: This gene encodes hepcidin, an antimicrobial peptide and master hormonal regulator of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Mice lacking the encoded protein develop multivisceral iron overlaod, with sparing of the spleen macrophages. Certain mutations in the human ortholog of this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016]