Fxyd4 (NM_033648) Mouse Untagged Clone

CAT#: MC212162

Fxyd4 (untagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd4
• Synonyms: 0610008I02Rik; AI267073; Chif
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212162 representing NM_033648
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGAAATCACCTGTGCCTTTCTCCTGCTGCTAGCAGGTCTGCCGGCCTTGGAAGCCAGTGACCCAG
  TTGATAAAGACAGTCCCTTCTACTATGACTGGGAGAGCCTGCAGCTGGGAGGATTGATTTTTGGAGGGCT
  CCTGTGCATCGCTGGAATTGCCATGGCCCTGAGTGGCAAGTGCAAATGTAGGCGTACCCATAAGCCCAGT
  TCCTTACCTGGAAAAGCCACTCCACTCATCATTCCAGGCTCTGCCAATACCTGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_033648
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_033648.1, NP_387468.1
• RefSeq Size: 554
• RefSeq ORF: 267
• Locus ID: 108017
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.