Clps (NM_025469) Mouse Untagged Clone

CAT#: MC212216

Clps (untagged) - Mouse colipase, pancreatic (Clps), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Clps
• Synonyms: 2200003J09Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212216 representing NM_025469
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGAAGGTCCTTGTTCTTCTGCTTGTGTCCCTCCTTGCAGTGGCCTATGCAGCTCCCGGACCCCGGG
  GTCTTATTATCAACCTGGAGGACGGTGAGATCTGTTTGAACAGTATGCAGTGTAAGAGCAGATGCTGCCA
  ACATGACACCATCCTGGGCATTGCCCGTTGCACACACAAGGCCATGGAGAACAGCGAGTGCTCCCCAAAG
  ACCCTCTATGGGATCTACTACCGGTGTCCCTGTGAGCGGGGCCTGACCTGTGAGGGGGACAGGAGCATCA
  TCGGCGCCATCACCAACACCAACTATGGCATCTGCCTCGACTCCAGGCGCTCCAAGCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_025469
• ORF Size: 342 bp
• Insert Size: 342
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_025469.3, NP_079745.1
• RefSeq Size: 557
• RefSeq ORF: 342
• Locus ID: 109791
• Gene Summary: This gene encodes a member of the colipase family of coenzymes that is required for the optimal activity of pancreatic lipase. The encoded protein undergoes proteolytic processing to generate a mature polypeptide that binds to the lipase and prevents inhibition by bile acids. Over half of the mice lacking the encoded protein die within two weeks of birth while the remaining ones exhibit fat malabsorption and altered body weight regulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).