Dars (NM_145507) Mouse Untagged Clone

CAT#: MC212782

Dars (untagged) - Mouse aspartyl-tRNA synthetase (Dars), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dars
• Synonyms: 5730439G15Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212782 representing NM_145507
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCAGCACCAACGCCAGCCGTAAGGGTCAGGAGAAGCCGCGGGAGATCGTGGACGCGGCGGAAGATT
  ATGCTAAAGAGAGATATGGGATATCTTCTATGATACAATCACAAGAAAAGCCAGATAGAGTTTTGGTTCG
  AGTTAAGGACCTGACAGTTCAAAAAGCTGATGATGTTGTTTGGGTCCGTGCAAGAGTTCATACAAGCAGA
  GCAAAAGACTGGGAACCTACCGACCGTTTGTTCTTTCTCTTTTTTAACTATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_145507
• ORF Size: 264 bp
• Insert Size: 264
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_145507.2, NP_663482.2
• RefSeq Size: 702
• RefSeq ORF: 264
• Locus ID: 226414
• Gene Summary: Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 3' UTR and includes an alternate 3' exon, but it lacks several exons in the 3' coding region compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.