Celf1 (NM_198683) Mouse Untagged Clone

CAT#: MC216621

Celf1 (untagged) - Mouse CUGBP, Elav-like family member 1 (Celf1), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Celf1
• Synonyms: 1600010O03Rik; AA407467; Brunol2; CUG-BP; CUG-BP1; CUGBP; Cugbp1; D2Wsu101e; HNAB50; NAB50
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC216621 representing NM_198683
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_198683
• ORF Size: 1461 bp
• Insert Size: 1461
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_198683.1, NP_941955.1
• RefSeq Size: 2197
• RefSeq ORF: 1461
• Locus ID: 13046