Oaz2 (NM_001301307) Mouse Untagged Clone

CAT#: MC225490

Oaz2 (untagged) - Mouse ornithine decarboxylase antizyme 2 (Oaz2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Oaz2
• Synonyms: AZ-2; AZ2; Oaz2-ps; Sez15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225490 representing NM_001301307
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATAAACACCCAGGACAGTATTTTGCCGTTGAGTAAGTGTCCCCAGCTCCAGTGCTGCAGGCACATTG
  TTCCAGGGCCTCTGTGGTGCTCCATGATAAACACCCAGGACAGTATTTTGCCGTTGAGTAAGTGTCCCCA
  GCTCCAGTGCTGCAGGCACATTGTTCCAGGGCCTCTGTGGTGCTCC
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301307
• ORF Size: 186 bp
• Insert Size: 186
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301307.1, NP_001288236.1
• RefSeq Size: 1858
• RefSeq ORF: 568
• Locus ID: 18247
• Gene Summary: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 2, the second member of the antizyme family. Like antizyme 1, antizyme 2 has broad tissue distribution, inhibits ODC activity and polyamine uptake, and stimulates ODC degradation in vivo; however, it fails to promote ODC degradation in vitro. Antizyme 2 is expressed at lower levels than antizyme 1, but is evolutionary more conserved, suggesting it likely has an important biological role. Studies also show different subcellular localization of antizymes 1 and 2, indicating specific function for each antizyme in discrete compartments of the cell. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) uses an alternate, in-frame acceptor splice site at the second exon compared to variant 1. The resulting isoform (2) is one amino acid shorter than isoform 1.