Nnat (NM_001291130) Mouse Untagged Clone

CAT#: MC225492

Nnat (untagged) - Mouse neuronatin (Nnat), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nnat
• Synonyms: 5730414I02Rik; AW107673; Peg5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225492 representing NM_001291130
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGCAGTGGCAGCAGCCTCGGCAGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC
  AGGTGTTCCTGGAATGCTGCATTTACTGGGTGTTCAGGTACTCCCTGCAGAAGCTGGCGCACACGGTGTC
  CCGGACCGGGCGGCAGGTGCTGGGGGAGCGCAGGCAGCGAGCCCCCAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291130
• ORF Size: 192 bp
• Insert Size: 192
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001291130.1, NP_001278059.1
• RefSeq Size: 1200
• RefSeq ORF: 192
• Locus ID: 18111
• Gene Summary: May participate in the maintenance of segment identity in the hindbrain and pituitary development, and maturation or maintenance of the overall structure of the nervous system. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) lacks an alternate exon but contains a different exon that results in a frameshift in the 3' coding region, compared to variant 3. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform c.