Cenpa (NM_001302131) Mouse Untagged Clone

CAT#: MC225676

Cenpa (untagged) - Mouse centromere protein A (Cenpa), transcript variant 4


  "NM_001302131" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cenpa"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cenpa
Synonyms Cenp-A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225676 representing NM_001302131
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGGCTCTCAGACACTGCGCAGAAGACAGAAATTCATGTGGCTTAAGGAAATCAAGACCCTGCAGA
AGAGCACAGACCTCTTGTTCAGGAAGAAGCCTTTCAGCATGGTTGTTAGAGAAATATGTGAGAAGTTCAG
CCGTGGTGTGGATTTTTGGTGGCAAGCCCAGGCCTTGTTGGCCCTTCAGGAGGCAGCAGAAGCTTTCCTC
ATCCACCTCTTTGAGGACGCCTACCTCCTCTCCTTACATGCTGGTCGGGTCACGCTTTTCCCCAAAGACA
TTCAGTTGACCAGGAGAATCCGAGGCTTCGAGGGCGGACTCCCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302131
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302131.1, NP_001289060.1
RefSeq Size 1555
RefSeq ORF 327
Locus ID 12615
Gene Summary Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (4) contains two alternate exons in the 5' coding region and uses a downstream start codon compared to variant 1. The resulting isoform (2) has a distinct shorter N-terminus, compared to isoform 1. Variants 2, 3 and 4 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.