Crkl (NM_001277231) Mouse Untagged Clone

CAT#: MC225678

Crkl (untagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian)-like (Crkl), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Crkl
• Synonyms: 1110025F07Rik; AA589403; AI325100; Crkol; snoop
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225678 representing NM_001277231
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCTCCGCCAGGTTTGATTCTTCAGACCGCTCTGCCTGGTACATGGGGCCAGTGACTCGCCAGGAGG
  CGCAGACTCGTCTCCAAGGCCAGCGCCATGGCATGTTCCTAGTCCGGGACTCATCTACCTGCCCCGGGGA
  CTATGTACTGTCCGTGTCCGAGAACTCGCGTGTCTCGCACTACATCATCAACTCCCTGCCCAACCGCCGC
  TTTAAGATCGGGGACCAGGAGTTTGACCATTTGCCGGCCTTGTTAGAGTTCTACAAGATCCACTACCTGG
  ACACTACCACCTTAATCGAACCGGCGCCCAGGTTGGTGACATTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277231
• ORF Size: 327 bp
• Insert Size: 327
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277231.1, NP_001264160.1
• RefSeq Size: 4584
• RefSeq ORF: 327
• Locus ID: 12929
• Gene Summary: This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In certain mouse genetic backgrounds this protein is essential for embryonic development. It is important for neural crest cell differentiation and survival and is proposed to play an important role in transducing the oncogenic signal of Bcr/Abl. Deletion of this gene in mouse mimics the phenotype of DiGeorge/velocardiofacial syndrome in human. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.