Cav2 (NM_001277756) Mouse Untagged Clone

CAT#: MC225696

Cav2 (untagged) - Mouse caveolin 2 (Cav2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cav2
• Synonyms: AI447843
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225696 representing NM_001277756
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGCTGGAGACCGAGAAGGCCGATGTGCAGCTCTTCATGGCCGATGACGCCTACAGCCACCACAGTG
  GCGTTGACTACGCAGATCCTGAGAAGTATGTTGACTCGAGTCACGACCGGGATCCTCACCAGCTCAACTC
  TCATCTCAAGCTAGGCTTCGAGGATCTGATTGCAGAGCCTGAGACTACACACTCCTTTGACAAAGTGTGG
  ATCTGCAGCCATGCTCTCTTTGAAATCAGCAAATATGTGATGTACAAGTTCCTGACCGTATTTCTGGCCA
  TCCCCTTGGCCTTCATTGCGGGTATCCTGTTTGCTACCCTCAGCTGTCTGCACATCTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277756
• ORF Size: 342 bp
• Insert Size: 342
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277756.1, NP_001264685.1
• RefSeq Size: 1116
• RefSeq ORF: 342
• Locus ID: 12390
• Gene Summary: This gene belongs to the caveolin family whose members encode the major protein components of caveolae, which are invaginations of plasma membrane. This gene is located adjacent to caveolin-1 and the proteins coexpressed by the two genes localize together in caveolae, where they form hetero-oligomers. The encoded protein may be involved in diverse cellular functions including proliferation, differentiation, endocytosis and trafficking. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
  Transcript Variant: This variant (2) transcribes past a splice site that is used in variant 1. This results in a novel 3' UTR, compared to variant 1. It encodes isoform 2 which is shorter at the C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.