Cenpa (NM_001302132) Mouse Untagged Clone

CAT#: MC225702

Cenpa (untagged) - Mouse centromere protein A (Cenpa), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cenpa
• Synonyms: Cenp-A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225702 representing NM_001302132
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCCCGCGTCGCAAACCGCAGACCCCAAGGAGGAGACCCTCCAGCCCGGCGCCTGGACCCTCGCGAC
  AGAGCTCCAGTGTAGGCTCTCAGACACTGCGCAGAAGACAGAAATTCATGTGGCTTAAGGAAATCAAGAC
  CCTGCAGAAGAGCACAGACCTCTTGTTCAGGAAGAAGCCTTTCAGCATGGTTGTTAGAGAAATATGTGAG
  AAGTTCAGCCGTGGTGTGGATTTTTGGTGGCAAGCCCAGGCCTTGTTGGCCCTTCAGGAGACATTACCTG
  GAAGCTTTTGGAGTTGCAGCTTGACAGTGGTGTCGGAGGAGCTGGCTGGGTTTTGCTGTTTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302132
• ORF Size: 345 bp
• Insert Size: 345
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302132.1, NP_001289061.1
• RefSeq Size: 1213
• RefSeq ORF: 345
• Locus ID: 12615
• Gene Summary: Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (5) lacks a 3' exon, which results in a frameshift, compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.